5′ ATGATTCGCCCATTTTCCTAG 3′ Coding (sense) strand 3′ TACTAAGCGGGTAAAAGGATC 5′ Template (antisense) 1. Rewrite the template strand; be sure to include…

5′ ATGATTCGCCCATTTTCCTAG 3′       Coding (sense) strand 

3′ TACTAAGCGGGTAAAAGGATC 5′   Template (antisense)

1. Rewrite the template strand; be sure to include the orientation

2. Transcribethe template to determine the mRNA, include the orientation

3.Translatethe mRNA to determine the amino acid sequence using the genetic code chart

List some differences between prokaryotic and eukaryotic transcription?

What are the 3 enzymes needed for eukaryotic transcription and how do they differ in function?

Mutations 

3′ TAC/ATA/GCG/GGT/AAA/AGG/ATC 5′                 DNA template

5′ AUG/UAU/CGC/CCA/UUU/UCC/UAG 3′               mRNA

    Met – tyr – arg – pro -phe – ser – STOP                 amino acid sequence

1.  How would the mRNA and the amino acid sequence change if second T were changed to an A?

3′ TACATAGCGGGTAAAAGGATC 5′ 

_____________________________________________________________mRNA

____________________________________________________amino acid sequence

2.  What if (in the DNA) the third A was mutated to T?

3′ TACATAGCGGGTAAAAGGATC 5′ 

_____________________________________________________________mRNA

____________________________________________________amino acid sequence

3.  What if the 6thA in the DNA were mutated to G?

3′ TACATAGCGGGTAAAAGGATC 5′ 

_____________________________________________________________mRNA

____________________________________________________amino acid sequence

4.  What if a G was inserted between the first C and A?

3′ TACATAGCGGGTAAAAGGATC 5′ 

______________________________________________________________mRNA

____________________________________________________amino acid sequence

What type of mutations are these above? (missense, nonsense, frameshift, silent)

1.

3.

2.

4.

"Looking for a Similar Assignment? Order now and Get a Discount!